logo





circRNA ID
1_circ_ag.36
Alias
ath_circ_000207
Organism
Arabidpsis thaliana
Position
chr1: 386428-456761  JBrowse»
Reference genome
TAIR10.38
Type  
ag-circRNA
Identification method
KNIFE
Parent gene
NA
Parent gene annotation
NA
Parent gene strand
NA
Splice junction sequence  
TTAGATTTCCACTATCTCTGTTTTTTTCTATCCAATGATTTACTGACTCTTCTTATGTTTTGTG
TTAAATCCTCTCCATAATCGTCTCACTAAAGATCAGgagatcatacaggagcaaataactagag
tgctgttggaacggctaattgtgaacaggccacatccatggggacttctaatcacattcattga
gctaataa
Support reads
7
Tissues
root
Exon boundary  
Yes-Yes
Splicing signals  
GT-AG
Sanger sequencing for BSS  
NA
PCR primers for BSS  
NA
Assembled circRNA sequence  
NA
Sanger sequencing for FL  
NA
PCR primers for FL  
NA
Genomic sequence
TOO LONG (>5KB) TO SHOW GENOMIC SEQUENCE OF THIS CIRCULAR RNA. PLEASE FIND THE CORRESPONDING GENOMIC SEQUENCE AT DOWNLOAD SECTION.
Number of exons covered
NA
Conserved circRNAs
NA
Coding potential
N
Potential coding position
NA
Potential amino acid sequence
NA
circRNA-miRNA-mRNA network
References
Chu et al., 2017

Copyright©2017-2021 Institute of Crop Sciences / Institute of Bioinformatics, Zhejiang University.
Any questions or suggestions, please contact the Fan's lab, bioinplant@zju.edu.cn
For submittion, please click here. Last modified at 2021-03-09.

Supported by   nsfc    zju