logo





circRNA ID
AT1G01650_circ_g.5
Alias
ath_circ_000094
Organism
Arabidpsis thaliana
Position
chr1: 234652-234934  JBrowse»
Reference genome
TAIR10.38
Type  
i-circRNA
Identification method
CIRCexplorer
Parent gene
Parent gene annotation
Signal peptide peptidase-like 4
Parent gene strand
-
Splice junction sequence  
GGTACGAGATGGCTAAAGGTGTTTGTCAACATGTGATATTTAGTGCCCTCATGATTGTAACGGC
AATCCCATGTGACATTTGATAAGGAATTGGTAATACtaactaatattgttattatagagattgg
tcttctatacattggcagaaatgattgtatccgtctaccagcagcaatcaaattttcagtcttc
aactgatt
Support reads
2
Tissues
seedlings
Exon boundary  
No-No
Splicing signals  
CT-CA
Sanger sequencing for BSS  
NA
PCR primers for BSS  
NA
Assembled circRNA sequence  
NA
Sanger sequencing for FL  
NA
PCR primers for FL  
NA
Genomic sequence
TAACTAATATTGTTATTATAGAGATTGGTCTTCTATACATTGGCAGAAATGATTGTATCCGTCT
ACCAGCAGCAATCAAATTTTCAGTCTTCAACTGATTGGTTTAGACAGTTGAATTTTCAACATGT
TAGAGCACAAATTCAGAATATATACACAGGAAAAGTGATGGTTCAAAACAAAGCTGGTACGAGA
TGGCTAAAGGTGTTTGTCAACATGTGATATTTAGTGCCCTCATGATTGTAACGGCAATCCCATG
TGACATTTGATAAGGAATTGGTAATAC
Number of exons covered
0
Conserved circRNAs
NA
Coding potential
N
Potential coding position
NA
Potential amino acid sequence
NA
Sponge-miRNAs
NA
circRNA-miRNA-mRNA network
References
Pan et al., 2017

Copyright©2017-2021 Institute of Crop Sciences / Institute of Bioinformatics, Zhejiang University.
Any questions or suggestions, please contact the Fan's lab, bioinplant@zju.edu.cn
For submittion, please click here. Last modified at 2021-03-09.

Supported by   nsfc    zju