Detail information of Os01g0607400_circ_g.17


General Information
CircRNA Name Os01g0607400_circ_g.17
ID in PlantcircBase osa_circ_002541
Alias NA
Organism Oryza sativa
Position chr1: 23944526-23944575  JBrowse»
Reference genome IRGSP-1.0.38
Type   e-circRNA
Identification method PcircRNA_finder
Parent gene Os01g0607400
Parent gene annotation Similar to STYLOSA protein. (Os01t0607400-01);Similar to STYLOSA
protein. (Os01t0607400-02)
Parent gene strand -
Alternative splicing Os01g0607400_circ_g.11 Os01g0607400_circ_g.12 Os01g0607400_circ_g.13 Os01g0607400_circ_g.14 Os01g0607400_circ_g.15 Os01g0607400_circ_g.16 Os01g0607400_circ_g.18 Os01g0607400_circ_g.19 Os01g0607400_circ_g.20 Os01g0607400_circ_g.21 Os01g0607400_circ_ag.1
Support reads 2
Tissues pistil
Exon boundary   Yes-Yes
Splicing signals   CT-AC
Number of exons covered Os01t0607400-01:1
Experimental Information
Sanger sequencing for BSS   NA
PCR primers for BSS    NA
Sanger sequencing for FL    NA
PCR primers for FL    NA
Sequences
Splice junction sequence   AAATTGTTTCCAGCTTGATTAGACCcgtgagtggccatcctttcagagtc
Assembled circRNA sequence   NA
Full-length trsnacripts NA
Genomic sequence CGTGAGTGGCCATCCTTTCAGAGTCAAATTGTTTCCAGCTTGATTAGACC
Conservation Information
Conserved circRNAs NA
PMCS 0.230001333
Functional Information
Coding potential Y
Potential coding position 23944540-23944551(-)
Potential amino acid sequence MATHGSNQAGNNLTLKGWPLTGLIKLETI*(-)
Sponge-miRNAs NA
circRNA-miRNA-mRNA network  VISUALIZATION
Potential function description NA
Other Information
References Chu et al., 2017