Detail information of Os03g0737000_circ_g.23


General Information
CircRNA Name Os03g0737000_circ_g.23
ID in PlantcircBase osa_circ_021733
Alias NA
Organism Oryza sativa
Position chr3: 30207071-30207131  JBrowse»
Reference genome IRGSP-1.0.38
Type   e-circRNA
Identification method PcircRNA_finder
Parent gene Os03g0737000
Parent gene annotation Cystathionine beta-synthase, core domain containing protein. (Os
03t0737000-01);Hypothetical gene. (Os03t0737000-02);Similar to C
BS domain containing protein, expressed. (Os03t0737000-03)
Parent gene strand -
Alternative splicing Os03g0737000_circ_g.24 Os03g0737000_circ_g.25 Os03g0737000_circ_g.26 Os03g0737000_circ_g.27 Os03g0737000_circ_g.28 Os03g0737000_circ_g.29 Os03g0737000_circ_g.30
Support reads 2
Tissues pistil
Exon boundary   Yes-Yes
Splicing signals   CT-AC
Number of exons covered Os03t0737000-03:1
Os03t0737000-01:1
Experimental Information
Sanger sequencing for BSS   NA
PCR primers for BSS    NA
Sanger sequencing for FL    NA
PCR primers for FL    NA
Sequences
Splice junction sequence   GGTATCAGGCTTCACCGTGATCAGCTGGTTctgtcatcagctgcattgcttgcaggactct
Assembled circRNA sequence   NA
Full-length trsnacripts NA
Genomic sequence CTGTCATCAGCTGCATTGCTTGCAGGACTCTGGTATCAGGCTTCACCGTGATCAGCTGGTT
Conservation Information
Conserved circRNAs NA
PMCS 0.423904098
Functional Information
Coding potential N
Potential coding position NA
Potential amino acid sequence NA
Sponge-miRNAs NA
circRNA-miRNA-mRNA network  VISUALIZATION
Potential function description NA
Other Information
References Chu et al., 2017