logo





circRNA ID
AT1G01520_circ_g.2
Alias
ath_circ_000073, At_ciR1526
Organism
Arabidpsis thaliana
Position
chr1: 191341-191692  JBrowse»
Reference genome
TAIR10.38
Type  
e-circRNA
Identification method
CIRCexplorer, PcircRNA_finder, circRNA_finder, find_circ, circseq_cup, CIRI-full
Parent gene
Parent gene annotation
ASG4
Parent gene strand
+
Splice junction sequence  
TCAGAGAACTGTTGCAGCACTAGTAGTAGTAGAGATAAGCAGAGGACTAGAATCGTTACAGAGA
CAAATGACCAAGAAAGTTGTGGAAAGCCACATAGAGttactctttcttcttcaaacgcattatt
tcaacatgactacttatacaacactaattcacatccggtgattagcaccacccgtaagcatgga
ttagtgca
Support reads
8/2
Tissues
leaf/whole_plant
Exon boundary  
Yes-Yes
Splicing signals  
GT-AG
Sanger sequencing for BSS  
NA
PCR primers for BSS  
NA
Assembled circRNA sequence  
TTACTCTTTCTTCTTCAAACGCATTATTTCAACATGACTACTTATACAACACTAATTCACATCC
GGTGATTAGCACCACCCGTAAGCATGGATTAGTGCATTGCGATGTTAGTATACCAAGTTCTGTT
ATCAAAGAGGAATTTGGTGTCTCAGAGAACTGTTGCAGCACTAGTAGTAGTAGAGATAAGCAGA
GGACTAGAATCGTTACAGAGACAAATGACCAAGAAAGTTGTGGAAAGCCACATAGAGTTACTCT
TTCTTCTTCAAACGCATTATTTCAACATGACTACTTATACAACACTAATTCACATCCGGTGATT
AGCACCACCCGTAAGCATGGATTAGTGCATTGCGATGTTAGTATACCAAGTTCTGTTATCAAAG
AGGAATTTGGTGTCTCAGAGAACTGTTGCAGCACTAGTAGTAGTAGAGATAAGCAGAGGACTAG
AATCGTTACAGAGACAAATGACCAAGAAAGTTGTGGAAAGCCACATAGAG
Sanger sequencing for FL  
NA
PCR primers for FL  
NA
Genomic sequence
TTACTCTTTCTTCTTCAAACGCATTATTTCAACATGACTACTTATACAACACTAATTCACATCC
GGTGATTAGCACCACCCGTAAGCATGGATTAGTGCATTGCGATGTTAGTATACCAAGTTCTGTT
ATCAAAGGTAAAATATGTGCTTAAGTTTGCTGTGTGGACTAATGTAATAATCTGAAGATATTGC
TTGTTTGAGTTGTTAATAATGTGGGGTAATGAATTTGTGATTGTAGAGGAATTTGGTGTCTCAG
AGAACTGTTGCAGCACTAGTAGTAGTAGAGATAAGCAGAGGACTAGAATCGTTACAGAGACAAA
TGACCAAGAAAGTTGTGGAAAGCCACATAGAG
Number of exons covered
AT1G01520.1:2
AT1G01520.5:2
AT1G01520.4:2
AT1G01520.2:2
AT1G01520.3:2
Conserved circRNAs
NA
Coding potential
N
Potential coding position
NA
Potential amino acid sequence
NA
Sponge-miRNAs
NA
circRNA-miRNA-mRNA network
References
Ye et al., 2015;Chu et al., 2017

Copyright©2017-2021 Institute of Crop Sciences / Institute of Bioinformatics, Zhejiang University.
Any questions or suggestions, please contact the Fan's lab, bioinplant@zju.edu.cn
For submittion, please click here. Last modified at 2021-03-09.

Supported by   nsfc    zju