Detail information of Os08g0526700_circ_g.5


General Information
CircRNA Name Os08g0526700_circ_g.5
ID in PlantcircBase osa_circ_042924
Alias NA
Organism Oryza sativa
Position chr8: 26217471-26217513  JBrowse»
Reference genome IRGSP-1.0.38
Type   u-circRNA
Identification method CIRI-long
Parent gene Os08g0526700
Parent gene annotation Similar to UBA/UBX 33.3 kDa protein. (Os08t0526700-00)
Parent gene strand +
Alternative splicing Os08g0526700_circ_g.2 Os08g0526700_circ_g.3 Os08g0526700_circ_g.4
Support reads NA
Tissues root, leaf
Exon boundary   No-No
Splicing signals   AT-AG
Number of exons covered Os08t0526700-00:1
Experimental Information
Sanger sequencing for BSS   NA
PCR primers for BSS    NA
Sanger sequencing for FL    NA
PCR primers for FL    NA
Sequences
Splice junction sequence   GAGAAAAGAACAAGAGAGAGAtcgaaaagcagatcaagaggag
Assembled circRNA sequence   Yes
Full-length trsnacripts Transcript length: 43
Transcript exons: 26217471-26217513
TCGAAAAGCAGATCAAGAGGAGGAGAAAAGAACAAGAGAGAGA

Genomic sequence TCGAAAAGCAGATCAAGAGGAGGAGAAAAGAACAAGAGAGAGA
Conservation Information
Conserved circRNAs NA
PMCS 0.312015891
Functional Information
Coding potential N
Potential coding position NA
Potential amino acid sequence NA
Sponge-miRNAs NA
circRNA-miRNA-mRNA network  VISUALIZATION
Potential function description NA
Other Information
References this study