Detail information of Os03g0107300_circ_g.21


General Information
CircRNA Name Os03g0107300_circ_g.21
ID in PlantcircBase osa_circ_017481
Alias NA
Organism Oryza sativa
Position chr3: 432687-432740  JBrowse»
Reference genome IRGSP-1.0.38
Type   ue-circRNA
Identification method CIRCexplorer
Parent gene Os03g0107300
Parent gene annotation Anion transporter, Silicon efflux transporter, Arsenic species (
As) uptake (Os03t0107300-01)
Parent gene strand -
Alternative splicing Os03g0107300_circ_g.15 Os03g0107300_circ_g.16 Os03g0107300_circ_g.17 Os03g0107300_circ_g.18 Os03g0107300_circ_g.19 Os03g0107300_circ_g.20 Os03g0107300_circ_g.22
Support reads 1
Tissues root
Exon boundary   No-No
Splicing signals   TC-GA
Number of exons covered Os03t0107300-01:1
Experimental Information
Sanger sequencing for BSS   NA
PCR primers for BSS    NA
Sanger sequencing for FL    NA
PCR primers for FL    NA
Sequences
Splice junction sequence   AAGCTCACTCATCTTCTTCTTCTTCGAtccaagcgccaccttgggcgccgacgc
Assembled circRNA sequence   NA
Full-length trsnacripts NA
Genomic sequence TCCAAGCGCCACCTTGGGCGCCGACGCAAGCTCACTCATCTTCTTCTTCTTCGA
Conservation Information
Conserved circRNAs NA
PMCS 0.37037037
Functional Information
Coding potential N
Potential coding position NA
Potential amino acid sequence NA
Sponge-miRNAs NA
circRNA-miRNA-mRNA network  VISUALIZATION
Potential function description NA
Other Information
References Chu et al., 2017