logo





circRNA ID
AT1G01080_circ_g.1
Alias
ath_circ_000014, Ath_circ_FC0114
Organism
Arabidpsis thaliana
Position
chr1: 45645-46145  JBrowse»
Reference genome
TAIR10.38
Type  
e-circRNA
Identification method
find_circ
Parent gene
Parent gene annotation
RNA-binding (RRM/RBD/RNP motifs) family protein
Parent gene strand
-
Alternative splicing
Splice junction sequence  
TTCCATCAAGAGAAGCAATGGCGATTTTGGCAGAGTTTATAGAACCCATTGTCACGTACCCGCT
TCCACGGCTCTCTCCCGTCTGAGGATTTCGCGATACctgttccattgaatgataaagccgcatc
acgttcttcaccgcttgtaaaagaaagaaaggcaaagactctgtttctcccggtcttacgatca
tgtaacac
Support reads
5
Tissues
whole_plant
Exon boundary  
No-Yes
Splicing signals  
CT-AA
Sanger sequencing for BSS  
NA
PCR primers for BSS  
NA
Assembled circRNA sequence  
NA
Sanger sequencing for FL  
NA
PCR primers for FL  
NA
Genomic sequence
CTGTTCCATTGAATGATAAAGCCGCATCACGTTCTTCACCGCTTGTAAAAGAAAGAAAGGCAAA
GACTCTGTTTCTCCCGGTCTTACGATCATGTAACACTCTCGTGCTTACGATTGTGCCAAACTTG
CTAAAGTGGTTTCTCAAACCATCAGGCTGTGTGAACCAAGGGAGATTTCCGACATAGACCTTGT
GTTGGCTTTCGTACATCAGAATCTTCTTTGGAGTTGAGTTCAAGACTTCAGGGTTTCTTCTTGT
TCCTGGATTCATGTCAACAGAGTACCTAACCCGCATTTCCCGACCACCTACTTCCTTCATATAT
AGCAACAAAACCAAAGCACTCAACTTTACACTCAACCAGAAGAAAGATAGACTTGTTTTTTGGT
TTCCCGGGCTCTTACTGTTCCATCAAGAGAAGCAATGGCGATTTTGGCAGAGTTTATAGAACCC
ATTGTCACGTACCCGCTTCCACGGCTCTCTCCCGTCTGAGGATTTCGCGATAC
Number of exons covered
AT1G01080.3:2
AT1G01080.1:2
AT1G01080.2:2
Conserved circRNAs
NA
Coding potential
N
Potential coding position
NA
Potential amino acid sequence
NA
Sponge-miRNAs
NA
circRNA-miRNA-mRNA network
References
Chen et al., 2017

Copyright©2017-2021 Institute of Crop Sciences / Institute of Bioinformatics, Zhejiang University.
Any questions or suggestions, please contact the Fan's lab, bioinplant@zju.edu.cn
For submittion, please click here. Last modified at 2021-03-09.

Supported by   nsfc    zju