Detail information of Os03g0655400_circ_g.3


General Information
CircRNA Name Os03g0655400_circ_g.3
ID in PlantcircBase osa_circ_020847
Alias NA
Organism Oryza sativa
Position chr3: 25563812-25563865  JBrowse»
Reference genome IRGSP-1.0.38
Type   e-circRNA
Identification method circRNA_finder
Parent gene Os03g0655400
Parent gene annotation Similar to LIP5. (Os03t0655400-01)
Parent gene strand +
Alternative splicing Os03g0655400_circ_g.1 Os03g0655400_circ_g.2 Os03g0655400_circ_g.4 Os03g0655400_circ_g.5 Os03g0655400_circ_g.6 Os03g0655400_circ_g.7
Support reads 33
Tissues leaf
Exon boundary   No-No
Splicing signals   GT-AG
Number of exons covered Os03t0655400-01:1
Experimental Information
Sanger sequencing for BSS   NA
PCR primers for BSS    NA
Sanger sequencing for FL    NA
PCR primers for FL    NA
Sequences
Splice junction sequence   AAGGACGGGGAGCACAAGGAAGGCGTGcacaagaaggagggggagcaccacaag
Assembled circRNA sequence   NA
Full-length trsnacripts NA
Genomic sequence CACAAGAAGGAGGGGGAGCACCACAAGAAGGACGGGGAGCACAAGGAAGGCGTG
Conservation Information
Conserved circRNAs NA
PMCS 0.286621296
Functional Information
Coding potential N
Potential coding position NA
Potential amino acid sequence NA
Sponge-miRNAs NA
circRNA-miRNA-mRNA network  VISUALIZATION
Potential function description NA
Other Information
References Chu et al., 2017