Detail information of AT3G08225_circ_g.1


General Information
CircRNA Name AT3G08225_circ_g.1
ID in PlantcircBase ath_circ_027071
Alias NA
Organism Arabidpsis thaliana
Position chr3: 19304583-19304635  JBrowse»
Reference genome TAIR10.38
Type   e-circRNA
Identification method PcircRNA_finder
Parent gene AT3G52040
Parent gene annotation 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase
Parent gene strand -
Alternative splicing NA
Support reads 2
Tissues leaf
Exon boundary   Yes-Yes
Splicing signals   CT-AC
Number of exons covered AT3G52040.1:1
Experimental Information
Sanger sequencing for BSS   NA
PCR primers for BSS    NA
Sanger sequencing for FL    NA
PCR primers for FL    NA
Sequences
Splice junction sequence   CTTTGTTGGTTTCACATTTCTCTTCCccgatcagtgtccatctctttcgtcat
Assembled circRNA sequence   NA
Full-length trsnacripts NA
Genomic sequence CCGATCAGTGTCCATCTCTTTCGTCATCTTTGTTGGTTTCACATTTCTCTTCC
Conservation Information
Conserved circRNAs NA
PMCS 0.114779875
Functional Information
Coding potential N
Potential coding position NA
Potential amino acid sequence NA
Sponge-miRNAs NA
circRNA-miRNA-mRNA network  VISUALIZATION
Potential function description NA
Other Information
References Chu et al., 2017