Detail information of AT1G21310_circ_g.18


General Information
CircRNA Name AT1G21310_circ_g.18
ID in PlantcircBase ath_circ_003755
Alias NA
Organism Arabidpsis thaliana
Position chr1: 7454781-7454834  JBrowse»
Reference genome TAIR10.38
Type   e-circRNA
Identification method CIRI
Parent gene AT1G21310
Parent gene annotation Extensin-3
Parent gene strand -
Alternative splicing NA
Support reads 2
Tissues root
Exon boundary   No-No
Splicing signals   GT-AG
Number of exons covered AT1G21310.1:1
Experimental Information
Sanger sequencing for BSS   NA
PCR primers for BSS    NA
Sanger sequencing for FL    NA
PCR primers for FL    NA
Sequences
Splice junction sequence   TAGGTGGTGGTGGGGAGTGGTATACCGgtggagatttgtattcgtagtgcttct
Assembled circRNA sequence   NA
Full-length trsnacripts NA
Genomic sequence GTGGAGATTTGTATTCGTAGTGCTTCTTAGGTGGTGGTGGGGAGTGGTATACCG
Conservation Information
Conserved circRNAs NA
PMCS 0.234567901
Functional Information
Coding potential N
Potential coding position NA
Potential amino acid sequence NA
Sponge-miRNAs NA
circRNA-miRNA-mRNA network  VISUALIZATION
Potential function description NA
Other Information
References Chu et al., 2017