Detail information of AT5G27395_circ_g.5


General Information
CircRNA Name AT5G27395_circ_g.5
ID in PlantcircBase ath_circ_040751
Alias NA
Organism Arabidpsis thaliana
Position chr5: 9673045-9673096  JBrowse»
Reference genome TAIR10.38
Type   e-circRNA
Identification method PcircRNA_finder
Parent gene AT5G27395
Parent gene annotation Mitochondrial inner membrane translocase complex, subunit Tim44-
related protein
Parent gene strand -
Alternative splicing AT5G27395_circ_g.1 AT5G27395_circ_g.2 AT5G27395_circ_g.3 AT5G27395_circ_g.4
Support reads 1
Tissues whole_plant
Exon boundary   Yes-Yes
Splicing signals   CT-AC
Number of exons covered AT5G27395.1:1
AT5G27395.2:1
Experimental Information
Sanger sequencing for BSS   NA
PCR primers for BSS    NA
Sanger sequencing for FL    NA
PCR primers for FL    NA
Sequences
Splice junction sequence   TTCGCCAACCACTTCTTGTAAAACATctcccgtataaaatcctctttcgttc
Assembled circRNA sequence   NA
Full-length trsnacripts NA
Genomic sequence CTCCCGTATAAAATCCTCTTTCGTTCTTCGCCAACCACTTCTTGTAAAACAT
Conservation Information
Conserved circRNAs NA
PMCS 0.185901283
Functional Information
Coding potential N
Potential coding position NA
Potential amino acid sequence NA
Sponge-miRNAs NA
circRNA-miRNA-mRNA network  VISUALIZATION
Potential function description NA
Other Information
References Chu et al., 2017