Detail information of GLYMA_10G067600_circ_g.5


General Information
CircRNA Name GLYMA_10G067600_circ_g.5
ID in PlantcircBase gma_circ_002597
Alias Gm10ciRNA2583
Organism Glycine max
Position chr10: 6652567-6652605  JBrowse»
Reference genome v2.0.38
Type   i-circRNA
Identification method Tophat, CIRI
Parent gene GLYMA_10G067600
Parent gene annotation hypothetical protein
Parent gene strand -
Alternative splicing GLYMA_10G067600_circ_g.1 GLYMA_10G067600_circ_g.2 GLYMA_10G067600_circ_g.3 GLYMA_10G067600_circ_g.4 GLYMA_10G067600_circ_g.6 GLYMA_10G067600_circ_g.7
Support reads NA
Tissues stem
Exon boundary   No-No
Splicing signals   TT-CT
Number of exons covered 0
Experimental Information
Sanger sequencing for BSS   NA
PCR primers for BSS    NA
Sanger sequencing for FL    NA
PCR primers for FL    NA
Sequences
Splice junction sequence   CAAGGTGATGGAACAAAACtataacccaagtgggggcac
Assembled circRNA sequence   NA
Full-length trsnacripts NA
Genomic sequence TATAACCCAAGTGGGGGCACCAAGGTGATGGAACAAAAC
Conservation Information
Conserved circRNAs NA
PMCS 0.287051282
Functional Information
Coding potential N
Potential coding position NA
Potential amino acid sequence NA
Sponge-miRNAs NA
circRNA-miRNA-mRNA network  VISUALIZATION
Potential function description NA
Other Information
References Zhao et al., 2017a