Detail information of AT3G52470_circ_g.3


General Information
CircRNA Name AT3G52470_circ_g.3
ID in PlantcircBase ath_circ_027166
Alias NA
Organism Arabidpsis thaliana
Position chr3: 19451173-19451225  JBrowse»
Reference genome TAIR10.38
Type   e-circRNA
Identification method CIRI, CIRI-full
Parent gene AT3G52470
Parent gene annotation Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprote
in family
Parent gene strand +
Alternative splicing AT3G52470_circ_g.2
Support reads 2
Tissues root
Exon boundary   No-No
Splicing signals   GT-AG
Number of exons covered AT3G52470.1:1
Experimental Information
Sanger sequencing for BSS   NA
PCR primers for BSS    NA
Sanger sequencing for FL    NA
PCR primers for FL    NA
Sequences
Splice junction sequence   ATGATACGCGCCGATGGGACCGTGAGgagaaagatcgtggatttgtagggttg
Assembled circRNA sequence   Yes
Full-length trsnacripts Transcript length: 53
Transcript exons: 19451173-19451225
GAGAAAGATCGTGGATTTGTAGGGTTGATGATACGCGCCGATGGGACCGTGAG

Genomic sequence GAGAAAGATCGTGGATTTGTAGGGTTGATGATACGCGCCGATGGGACCGTGAG
Conservation Information
Conserved circRNAs NA
PMCS 0.146227201
Functional Information
Coding potential N
Potential coding position NA
Potential amino acid sequence NA
Sponge-miRNAs NA
circRNA-miRNA-mRNA network  VISUALIZATION
Potential function description NA
Other Information
References Chu et al., 2017