Detail information of AT4G15780_circ_g.1


General Information
CircRNA Name AT4G15780_circ_g.1
ID in PlantcircBase ath_circ_031115
Alias NA
Organism Arabidpsis thaliana
Position chr4: 8980320-8980382  JBrowse»
Reference genome TAIR10.38
Type   e-circRNA
Identification method PcircRNA_finder
Parent gene AT4G15780
Parent gene annotation vesicle-associated membrane protein 724
Parent gene strand -
Alternative splicing NA
Support reads 1
Tissues whole_plant
Exon boundary   Yes-Yes
Splicing signals   CT-AC
Number of exons covered AT4G15780.1:1
Experimental Information
Sanger sequencing for BSS   NA
PCR primers for BSS    NA
Sanger sequencing for FL    NA
PCR primers for FL    NA
Sequences
Splice junction sequence   GAACTGTTAGATTTTCCCCTCTGTCGATTGCctgagagcgtagattctcggtcttgtcagtaa
Assembled circRNA sequence   NA
Full-length trsnacripts NA
Genomic sequence CTGAGAGCGTAGATTCTCGGTCTTGTCAGTAAGAACTGTTAGATTTTCCCCTCTGTCGATTGC
Conservation Information
Conserved circRNAs NA
PMCS 0.240740739
Functional Information
Coding potential N
Potential coding position NA
Potential amino acid sequence NA
Sponge-miRNAs NA
circRNA-miRNA-mRNA network  VISUALIZATION
Potential function description NA
Other Information
References Chu et al., 2017