logo





circRNA ID
AT1G01490_circ_g.1
Alias
ath_circ_000071
Organism
Arabidpsis thaliana
Position
chr1: 180583-180694  JBrowse»
Reference genome
TAIR10.38
Type  
e-circRNA
Identification method
circRNA_finder, find_circ, CIRI-full
Parent gene
Parent gene annotation
Heavy metal transport/detoxification superfamily protein
Parent gene strand
-
Alternative splicing
NA
Splice junction sequence  
TTTGGAGCTTCTCCTTCTTTCTTTGGCGGCTCGCCACCACCTTCCTTCTTCGGCTCcttctttc
ttctcttcttccttcttcggtgcttctccttcctttttcccttcttct
Support reads
4
Tissues
leaf
Exon boundary  
No-No
Splicing signals  
CT-AC
Sanger sequencing for BSS  
NA
PCR primers for BSS  
NA
Assembled circRNA sequence  
CTTCTTTCTTCTCTTCTTCCTTCTTCGGTGCTTCTCCTTCCTTTTTCCCTTCTTCTTTTGGAGC
TTCTCCTTCTTTCTTTGGCGGCTCGCCACCACCTTCCTTCTTCGGCTC
Sanger sequencing for FL  
NA
PCR primers for FL  
NA
Genomic sequence
CTTCTTTCTTCTCTTCTTCCTTCTTCGGTGCTTCTCCTTCCTTTTTCCCTTCTTCTTTTGGAGC
TTCTCCTTCTTTCTTTGGCGGCTCGCCACCACCTTCCTTCTTCGGCTC
Number of exons covered
AT1G01490.3:1
AT1G01490.2:1
AT1G01490.1:1
AT1G01490.4:1
Conserved circRNAs
NA
Coding potential
N
Potential coding position
NA
Potential amino acid sequence
NA
Sponge-miRNAs
NA
circRNA-miRNA-mRNA network
References
Chu et al., 2017

Copyright©2017-2021 Institute of Crop Sciences / Institute of Bioinformatics, Zhejiang University.
Any questions or suggestions, please contact the Fan's lab, bioinplant@zju.edu.cn
For submittion, please click here. Last modified at 2021-03-09.

Supported by   nsfc    zju