Detail information of Zm00001d039104_circ_g.2


General Information
CircRNA Name Zm00001d039104_circ_g.2
ID in PlantcircBase zma_circ_005359
Alias cold_test_circ_001826
Organism Zea mays
Position chr6: 170110431-170110485  JBrowse»
Reference genome AGPv4.38
Type   e-circRNA
Identification method find_circ
Parent gene Zm00001d039104
Parent gene annotation Protein CHUP1 chloroplastic
Parent gene strand -
Alternative splicing NA
Support reads NA
Tissues seedling
Exon boundary   No-No
Splicing signals   GT-GA
Number of exons covered Zm00001d039104_T001:1
Experimental Information
Sanger sequencing for BSS   NA
PCR primers for BSS    NA
Sanger sequencing for FL    NA
PCR primers for FL    NA
Sequences
Splice junction sequence   CTTTCCCTGGAGGTGGTGGTGGAGGAGggtggcggtggtggcggtgggccaccaa
Assembled circRNA sequence   NA
Full-length trsnacripts NA
Genomic sequence GGTGGCGGTGGTGGCGGTGGGCCACCAACTTTCCCTGGAGGTGGTGGTGGAGGAG
Conservation Information
Conserved circRNAs NA
PMCS 0.575952576
Functional Information
Coding potential N
Potential coding position NA
Potential amino acid sequence NA
Sponge-miRNAs NA
circRNA-miRNA-mRNA network  VISUALIZATION
Potential function description NA
Other Information
References Tang et al., 2018