Detail information of AT4G02570_circ_g.2


General Information
CircRNA Name AT4G02570_circ_g.2
ID in PlantcircBase ath_circ_029409
Alias NA
Organism Arabidpsis thaliana
Position chr4: 1128664-1128725  JBrowse»
Reference genome TAIR10.38
Type   u-circRNA
Identification method CIRCexplorer
Parent gene AT4G02570
Parent gene annotation AT4G02570 protein
Parent gene strand +
Alternative splicing AT4G02570_circ_g.1 AT4G02570_circ_g.3
Support reads 1
Tissues root
Exon boundary   No-No
Splicing signals   CT-AG
Number of exons covered AT4G02570.1:1
Experimental Information
Sanger sequencing for BSS   NA
PCR primers for BSS    NA
Sanger sequencing for FL    NA
PCR primers for FL    NA
Sequences
Splice junction sequence   TTTTTCCTGAACGATTCTTAGGGTTTTGATTgtctcgtctctctttctctctattttacgct
Assembled circRNA sequence   NA
Full-length trsnacripts NA
Genomic sequence GTCTCGTCTCTCTTTCTCTCTATTTTACGCTTTTTTCCTGAACGATTCTTAGGGTTTTGATT
Conservation Information
Conserved circRNAs NA
PMCS 0.355126471
Functional Information
Coding potential N
Potential coding position NA
Potential amino acid sequence NA
Sponge-miRNAs NA
circRNA-miRNA-mRNA network  VISUALIZATION
Potential function description NA
Other Information
References Chu et al., 2017