Detail information of AT3G60640_circ_g.2


General Information
CircRNA Name AT3G60640_circ_g.2
ID in PlantcircBase ath_circ_028474
Alias NA
Organism Arabidpsis thaliana
Position chr3: 22416105-22416154  JBrowse»
Reference genome TAIR10.38
Type   ue-circRNA
Identification method PcircRNA_finder
Parent gene AT3G60640
Parent gene annotation Autophagy-related protein 8g
Parent gene strand +
Alternative splicing AT3G60640_circ_g.1 AT3G60640_circ_g.3
Support reads 2
Tissues whole_plant
Exon boundary   Yes-Yes
Splicing signals   GT-AG
Number of exons covered AT3G60640.1:1
Experimental Information
Sanger sequencing for BSS   NA
PCR primers for BSS    NA
Sanger sequencing for FL    NA
PCR primers for FL    NA
Sequences
Splice junction sequence   AGCTTCAGGCAGGATCATGATTTCGgaatcaaaagaagatgagtaacgtc
Assembled circRNA sequence   NA
Full-length trsnacripts NA
Genomic sequence GAATCAAAAGAAGATGAGTAACGTCAGCTTCAGGCAGGATCATGATTTCG
Conservation Information
Conserved circRNAs NA
PMCS 0.083333333
Functional Information
Coding potential N
Potential coding position NA
Potential amino acid sequence NA
Sponge-miRNAs NA
circRNA-miRNA-mRNA network  VISUALIZATION
Potential function description NA
Other Information
References Chu et al., 2017