Detail information of Os03g0439800_circ_g.1


General Information
CircRNA Name Os03g0439800_circ_g.1
ID in PlantcircBase osa_circ_020434
Alias NA
Organism Oryza sativa
Position chr3: 18580066-18580106  JBrowse»
Reference genome IRGSP-1.0.38
Type   e-circRNA
Identification method PcircRNA_finder
Parent gene Os03g0439800
Parent gene annotation Protein of unknown function DUF1909 domain containing protein. (
Os03t0439800-01);Similar to predicted protein. (Os03t0439800-02)
Parent gene strand +
Alternative splicing NA
Support reads 3
Tissues seed
Exon boundary   Yes-Yes
Splicing signals   GT-AG
Number of exons covered Os03t0439800-01:1
Os03t0439800-02:1
Experimental Information
Sanger sequencing for BSS   NA
PCR primers for BSS    NA
Sanger sequencing for FL    NA
PCR primers for FL    NA
Sequences
Splice junction sequence   AGAAGGCCATGAACATCCAGggagccagcttgagaccaaca
Assembled circRNA sequence   NA
Full-length trsnacripts NA
Genomic sequence GGAGCCAGCTTGAGACCAACAAGAAGGCCATGAACATCCAG
Conservation Information
Conserved circRNAs NA
PMCS 0.434956301
Functional Information
Coding potential N
Potential coding position NA
Potential amino acid sequence NA
Sponge-miRNAs NA
circRNA-miRNA-mRNA network  VISUALIZATION
Potential function description NA
Other Information
References Chu et al., 2017