Detail information of AT3G26650_circ_g.7


General Information
CircRNA Name AT3G26650_circ_g.7
ID in PlantcircBase ath_circ_023957
Alias NA
Organism Arabidpsis thaliana
Position chr3: 9796507-9796583  JBrowse»
Reference genome TAIR10.38
Type   e-circRNA
Identification method CIRI, circRNA_finder, circseq_cup
Parent gene AT3G26650
Parent gene annotation Glyceraldehyde-3-phosphate dehydrogenase GAPA1, chloroplastic
Parent gene strand +
Alternative splicing AT3G26650_circ_g.8 AT3G26650_circ_g.9
Support reads 2
Tissues leaf, aerial
Exon boundary   No-No
Splicing signals   CT-AC
Number of exons covered AT3G26650.1:1
Experimental Information
Sanger sequencing for BSS   NA
PCR primers for BSS    NA
Sanger sequencing for FL    NA
PCR primers for FL    NA
Sequences
Splice junction sequence   ACACCAAACGTATCAGTGGTTGATCTCGTTGTGCAGGTctcaaaggaaaactcaacgggatcgc
tctccgtgtacca
Assembled circRNA sequence   Yes
Full-length trsnacripts Transcript length: 77
Transcript exons: 9796507-9796583
CTCAAAGGAAAACTCAACGGGATCGCTCTCCGTGTACCAACACCAAACGTATCAGTGGTTGATC
TCGTTGTGCAGGT

Genomic sequence CTCAAAGGAAAACTCAACGGGATCGCTCTCCGTGTACCAACACCAAACGTATCAGTGGTTGATC
TCGTTGTGCAGGT
Conservation Information
Conserved circRNAs NA
PMCS 0.366340047
Functional Information
Coding potential N
Potential coding position NA
Potential amino acid sequence NA
Sponge-miRNAs NA
circRNA-miRNA-mRNA network  VISUALIZATION
Potential function description NA
Other Information
References Chu et al., 2017