Detail information of AT3G26430_circ_g.3


General Information
CircRNA Name AT3G26430_circ_g.3
ID in PlantcircBase ath_circ_023902
Alias NA
Organism Arabidpsis thaliana
Position chr3: 9672770-9672853  JBrowse»
Reference genome TAIR10.38
Type   u-circRNA
Identification method circRNA_finder
Parent gene AT3G26430
Parent gene annotation GDSL esterase/lipase At3g26430
Parent gene strand +
Alternative splicing AT3G26430_circ_g.1 AT3G26430_circ_g.2 AT3G26430_circ_g.4 AT3G26430_circ_g.5 AT3G26430_circ_g.6 AT3G26430_circ_g.7 AT3G26430_circ_g.8 AT3G26430_circ_g.9
Support reads 14
Tissues root, aerial
Exon boundary   No-No
Splicing signals   GT-AG
Number of exons covered AT3G26420.1:1
AT3G26430.1:1
AT3G26420.1:1
Experimental Information
Sanger sequencing for BSS   NA
PCR primers for BSS    NA
Sanger sequencing for FL    NA
PCR primers for FL    NA
Sequences
Splice junction sequence   GTATGGTGCAAAGGAGGATAGGTATGGTGCAAAGGATGATAGgtacagttcgaaggacgatagg
tatggtgcaaaagatgatag
Assembled circRNA sequence   NA
Full-length trsnacripts NA
Genomic sequence GTACAGTTCGAAGGACGATAGGTATGGTGCAAAAGATGATAGGTATGGTGCAAAGGAGGATAGG
TATGGTGCAAAGGATGATAG
Conservation Information
Conserved circRNAs NA
PMCS 0.418981481
Functional Information
Coding potential N
Potential coding position NA
Potential amino acid sequence NA
Sponge-miRNAs NA
circRNA-miRNA-mRNA network  VISUALIZATION
Potential function description NA
Other Information
References Chu et al., 2017