Detail information of Zm00001d027509_circ_ig.1


General Information
CircRNA Name Zm00001d027509_circ_ig.1
ID in PlantcircBase zma_circ_003284
Alias control_test_circ_005990
Organism Zea mays
Position chr1: 7075108-7075160  JBrowse»
Reference genome AGPv4.38
Type   ig-circRNA
Identification method find_circ
Parent gene NA
Parent gene annotation NA
Parent gene strand NA
Alternative splicing NA
Support reads NA
Tissues seedling
Exon boundary   NA-NA
Splicing signals   CT-AA
Number of exons covered NA
Experimental Information
Sanger sequencing for BSS   NA
PCR primers for BSS    NA
Sanger sequencing for FL    NA
PCR primers for FL    NA
Sequences
Splice junction sequence   ATGCAACTTGGTCGTGATTACTTAACcctaatccaaaagaacttacaagcgcg
Assembled circRNA sequence   NA
Full-length trsnacripts NA
Genomic sequence CCTAATCCAAAAGAACTTACAAGCGCGATGCAACTTGGTCGTGATTACTTAAC
Conservation Information
Conserved circRNAs NA
PMCS 0.319178616
Functional Information
Coding potential N
Potential coding position NA
Potential amino acid sequence NA
Sponge-miRNAs NA
circRNA-miRNA-mRNA network  VISUALIZATION
Potential function description NA
Other Information
References Tang et al., 2018