Detail information of Os05g0575300_circ_g.1


General Information
CircRNA Name Os05g0575300_circ_g.1
ID in PlantcircBase osa_circ_042196
Alias NA
Organism Oryza sativa
Position chr5: 28655821-28655878  JBrowse»
Reference genome IRGSP-1.0.38
Type   e-circRNA
Identification method CIRI-long
Parent gene Os05g0575300
Parent gene annotation Similar to Translation initiation factor IF-2. (Os05t0575300-01)
;Similar to Translation initiation factor IF-2, chloroplast prec
ursor (PvIF2cp). (Os05t0575300-02)
Parent gene strand +
Alternative splicing NA
Support reads NA
Tissues leaf
Exon boundary   No-No
Splicing signals   AT-AC
Number of exons covered Os05t0575300-01:1
Experimental Information
Sanger sequencing for BSS   NA
PCR primers for BSS    NA
Sanger sequencing for FL    NA
PCR primers for FL    NA
Sequences
Splice junction sequence   GAGGATACTGCAGTGCGCAAGGGGAGGAGgaatgccaaaaaatgatggtttagttgat
Assembled circRNA sequence   Yes
Full-length trsnacripts Transcript length: 58
Transcript exons: 28655821-28655878
GAATGCCAAAAAATGATGGTTTAGTTGATGAGGATACTGCAGTGCGCAAGGGGAGGAG

Genomic sequence GAATGCCAAAAAATGATGGTTTAGTTGATGAGGATACTGCAGTGCGCAAGGGGAGGAG
Conservation Information
Conserved circRNAs NA
PMCS 0.113505747
Functional Information
Coding potential N
Potential coding position NA
Potential amino acid sequence NA
Sponge-miRNAs NA
circRNA-miRNA-mRNA network  VISUALIZATION
Potential function description NA
Other Information
References this study