Detail information of AT3G22260_circ_g.2


General Information
CircRNA Name AT3G22260_circ_g.2
ID in PlantcircBase ath_circ_023197
Alias Ath_circ_FC2118
Organism Arabidpsis thaliana
Position chr3: 7871460-7871698  JBrowse»
Reference genome TAIR10.38
Type   ue-circRNA
Identification method find_circ
Parent gene AT3G22260
Parent gene annotation At3g22260
Parent gene strand +
Alternative splicing AT3G22260_circ_g.1 AT3G22260_circ_g.3
Support reads 8
Tissues whole_plant
Exon boundary   No-Yes
Splicing signals   GT-TA
Number of exons covered AT3G22260.2:1
AT3G22260.3:1
AT3G22260.1:1
AT3G22260.6:1
AT3G22260.4:1
AT3G22260.5:1
Experimental Information
Sanger sequencing for BSS   NA
PCR primers for BSS    NA
Sanger sequencing for FL    NA
PCR primers for FL    NA
Sequences
Splice junction sequence   AGATGATGATCAGACCATTGCACGTATATTAGCTGAAGATGAGAGCTTGAGAAGAGAAGGCAAG
CTTGGGAAGAGATTATCTCATTTGGATTCTATCCCAggttgtatttagtataggatccaaatac
aatggatgaaaaccataggaatccatttgcaaatgcaagtacaagtgctagagcaagcggcagt
acaagtgc
Assembled circRNA sequence   NA
Full-length trsnacripts NA
Genomic sequence GGTTGTATTTAGTATAGGATCCAAATACAATGGATGAAAACCATAGGAATCCATTTGCAAATGC
AAGTACAAGTGCTAGAGCAAGCGGCAGTACAAGTGCGAGCTCAAACTCGAGTTTTAGTAGCAGT
GTGGCGGATACAGATGATGATCAGACCATTGCACGTATATTAGCTGAAGATGAGAGCTTGAGAA
GAGAAGGCAAGCTTGGGAAGAGATTATCTCATTTGGATTCTATCCCA
Conservation Information
Conserved circRNAs NA
PMCS 0.180879533
Functional Information
Coding potential N
Potential coding position NA
Potential amino acid sequence NA
Sponge-miRNAs NA
circRNA-miRNA-mRNA network  VISUALIZATION
Potential function description NA
Other Information
References Chen et al., 2017a