Detail information of AT3G19670_circ_g.15


General Information
CircRNA Name AT3G19670_circ_g.15
ID in PlantcircBase ath_circ_022743
Alias NA
Organism Arabidpsis thaliana
Position chr3: 6836263-6836331  JBrowse»
Reference genome TAIR10.38
Type   e-circRNA
Identification method PcircRNA_finder
Parent gene AT3G19670
Parent gene annotation Pre-mRNA-processing protein 40B
Parent gene strand -
Alternative splicing NA
Support reads 2
Tissues leaf
Exon boundary   Yes-Yes
Splicing signals   CT-AC
Number of exons covered AT3G19670.1:1
AT3G19670.2:1
AT3G19670.4:1
AT3G19670.3:1
Experimental Information
Sanger sequencing for BSS   NA
PCR primers for BSS    NA
Sanger sequencing for FL    NA
PCR primers for FL    NA
Sequences
Splice junction sequence   AATCTATGGAGCTAGCATTAGGATGCTGGAATGGctgaaagttcatgggtggagcaaagcctcg
gggta
Assembled circRNA sequence   NA
Full-length trsnacripts NA
Genomic sequence CTGAAAGTTCATGGGTGGAGCAAAGCCTCGGGGTAAATCTATGGAGCTAGCATTAGGATGCTGG
AATGG
Conservation Information
Conserved circRNAs NA
PMCS 0.20772585
Functional Information
Coding potential Y
Potential coding position 6836275-6836265(-)
Potential amino acid sequence MNFQPFQHPNASSIDLPRGFAPPMNFQPFQHPNASSIDLPRGFAPPMNFQPFQHPNASSIDLPR
GFAPPMNFQ(-)
Sponge-miRNAs NA
circRNA-miRNA-mRNA network  VISUALIZATION
Potential function description NA
Other Information
References Chu et al., 2017