Detail information of Os01g0919600_circ_g.13


General Information
CircRNA Name Os01g0919600_circ_g.13
ID in PlantcircBase osa_circ_005514
Alias NA
Organism Oryza sativa
Position chr1: 40131903-40131957  JBrowse»
Reference genome IRGSP-1.0.38
Type   e-circRNA
Identification method CIRCexplorer
Parent gene Os01g0919600
Parent gene annotation Protein of unknown function DUF707 family protein. (Os01t0919600
-01);Similar to predicted protein. (Os01t0919600-02)
Parent gene strand +
Alternative splicing Os01g0919600_circ_g.14
Support reads 1
Tissues leaf
Exon boundary   No-No
Splicing signals   CG-CG
Number of exons covered Os01t0919600-01:1
Os01t0919600-02:1
Experimental Information
Sanger sequencing for BSS   NA
PCR primers for BSS    NA
Sanger sequencing for FL    NA
PCR primers for FL    NA
Sequences
Splice junction sequence   CGTCGACAGCGAGTACGTCCTCCACCGgcggcgaccggaggctcgccgtcggcat
Assembled circRNA sequence   NA
Full-length trsnacripts NA
Genomic sequence GCGGCGACCGGAGGCTCGCCGTCGGCATCGTCGACAGCGAGTACGTCCTCCACCG
Conservation Information
Conserved circRNAs NA
PMCS 0.260716818
Functional Information
Coding potential N
Potential coding position NA
Potential amino acid sequence NA
Sponge-miRNAs NA
circRNA-miRNA-mRNA network  VISUALIZATION
Potential function description NA
Other Information
References Chu et al., 2017