Detail information of Zm00001d039936_circ_igg.2


General Information
CircRNA Name Zm00001d039936_circ_igg.2
ID in PlantcircBase zma_circ_004158
Alias heat_test_circ_007641
Organism Zea mays
Position chr3: 19966637-19966692  JBrowse»
Reference genome AGPv4.38
Type   igg-circRNA
Identification method find_circ
Parent gene NA
Parent gene annotation NA
Parent gene strand NA
Alternative splicing Zm00001d039936_circ_igg.3
Support reads NA
Tissues seedling
Exon boundary   NA-NA
Splicing signals   TG-AG
Number of exons covered NA
Experimental Information
Sanger sequencing for BSS   NA
PCR primers for BSS    NA
Sanger sequencing for FL    NA
PCR primers for FL    NA
Sequences
Splice junction sequence   CATCCAATCCAATATGGACGATTGGACGgtgaaggctattgagatctctggttgag
Assembled circRNA sequence   NA
Full-length trsnacripts NA
Genomic sequence GTGAAGGCTATTGAGATCTCTGGTTGAGCATCCAATCCAATATGGACGATTGGACG
Conservation Information
Conserved circRNAs NA
PMCS 0.424107143
Functional Information
Coding potential N
Potential coding position NA
Potential amino acid sequence NA
Sponge-miRNAs NA
circRNA-miRNA-mRNA network  VISUALIZATION
Potential function description NA
Other Information
References Tang et al., 2018