Detail information of AT1G22630_circ_g.1


General Information
CircRNA Name AT1G22630_circ_g.1
ID in PlantcircBase ath_circ_003920
Alias NA
Organism Arabidpsis thaliana
Position chr1: 8003927-8003973  JBrowse»
Reference genome TAIR10.38
Type   e-circRNA
Identification method PcircRNA_finder
Parent gene AT1G22630
Parent gene annotation At1g22630/F12K8_2
Parent gene strand +
Alternative splicing NA
Support reads 4
Tissues leaf, aerial, inflorescences, whole_plant
Exon boundary   Yes-Yes
Splicing signals   GT-AG
Number of exons covered AT1G22630.1:1
Experimental Information
Sanger sequencing for BSS   NA
PCR primers for BSS    NA
Sanger sequencing for FL    NA
PCR primers for FL    NA
Sequences
Splice junction sequence   GGAAATATGTTTGAGAGGTGGAAggaacaggtaaaaataagaagaac
Assembled circRNA sequence   NA
Full-length trsnacripts NA
Genomic sequence GGAACAGGTAAAAATAAGAAGAACGGAAATATGTTTGAGAGGTGGAA
Conservation Information
Conserved circRNAs NA
PMCS 0.156028368
Functional Information
Coding potential N
Potential coding position NA
Potential amino acid sequence NA
Sponge-miRNAs NA
circRNA-miRNA-mRNA network  VISUALIZATION
Potential function description NA
Other Information
References Chu et al., 2017