Detail information of Zm00001d018779_circ_g.9


General Information
CircRNA Name Zm00001d018779_circ_g.9
ID in PlantcircBase zma_circ_005382
Alias cold_test_circ_002616
Organism Zea mays
Position chr7: 5053225-5053286  JBrowse»
Reference genome AGPv4.38
Type   e-circRNA
Identification method find_circ
Parent gene Zm00001d018779
Parent gene annotation Oxygen-evolving enhancer protein 2-1 chloroplastic
Parent gene strand -
Alternative splicing Zm00001d018779_circ_g.4 Zm00001d018779_circ_g.5 Zm00001d018779_circ_g.6 Zm00001d018779_circ_g.7 Zm00001d018779_circ_g.8
Support reads NA
Tissues seedling
Exon boundary   No-No
Splicing signals   GT-GA
Number of exons covered Zm00001d018779_T001:1
Experimental Information
Sanger sequencing for BSS   NA
PCR primers for BSS    NA
Sanger sequencing for FL    NA
PCR primers for FL    NA
Sequences
Splice junction sequence   CCGGACTCGTGGGGGAGAAGAGTGTGCGTGGggtggacgccatggcttggctcctccggggt
Assembled circRNA sequence   NA
Full-length trsnacripts NA
Genomic sequence GGTGGACGCCATGGCTTGGCTCCTCCGGGGTCCGGACTCGTGGGGGAGAAGAGTGTGCGTGG
Conservation Information
Conserved circRNAs NA
PMCS 0.497316129
Functional Information
Coding potential N
Potential coding position NA
Potential amino acid sequence NA
Sponge-miRNAs NA
circRNA-miRNA-mRNA network  VISUALIZATION
Potential function description NA
Other Information
References Tang et al., 2018