Detail information of AT1G50010_circ_g.5


General Information
CircRNA Name AT1G50010_circ_g.5
ID in PlantcircBase ath_circ_006543
Alias NA
Organism Arabidpsis thaliana
Position chr1: 18519679-18519733  JBrowse»
Reference genome TAIR10.38
Type   ue-circRNA
Identification method CIRI, CIRI-full
Parent gene AT1G50010
Parent gene annotation Tubulin alpha-2 chain
Parent gene strand +
Alternative splicing AT1G50010_circ_g.1 AT1G50010_circ_g.2 AT1G50010_circ_g.3 AT1G50010_circ_g.4 AT1G50010_circ_g.6
Support reads 10
Tissues root, aerial
Exon boundary   No-No
Splicing signals   GT-AG
Number of exons covered AT1G50010.1:1
Experimental Information
Sanger sequencing for BSS   NA
PCR primers for BSS    NA
Sanger sequencing for FL    NA
PCR primers for FL    NA
Sequences
Splice junction sequence   ATGATGAAGGAGAGGAGTACTAAGAAGgttggtgctgaaggtggtgacgatgagg
Assembled circRNA sequence   Yes
Full-length trsnacripts Transcript length: 55
Transcript exons: 18519679-18519733
GTTGGTGCTGAAGGTGGTGACGATGAGGATGATGAAGGAGAGGAGTACTAAGAAG

Genomic sequence GTTGGTGCTGAAGGTGGTGACGATGAGGATGATGAAGGAGAGGAGTACTAAGAAG
Conservation Information
Conserved circRNAs NA
PMCS 0.460603789
Functional Information
Coding potential N
Potential coding position NA
Potential amino acid sequence NA
Sponge-miRNAs NA
circRNA-miRNA-mRNA network  VISUALIZATION
Potential function description NA
Other Information
References Chu et al., 2017