Detail information of AT4G15545_circ_g.2


General Information
CircRNA Name AT4G15545_circ_g.2
ID in PlantcircBase ath_circ_031091
Alias NA
Organism Arabidpsis thaliana
Position chr4: 8876643-8876682  JBrowse»
Reference genome TAIR10.38
Type   e-circRNA
Identification method PcircRNA_finder
Parent gene AT4G15545
Parent gene annotation Uncharacterized protein At4g15545
Parent gene strand +
Alternative splicing AT4G15545_circ_g.1
Support reads 6
Tissues leaf, aerial, whole_plant
Exon boundary   Yes-Yes
Splicing signals   GT-AG
Number of exons covered AT4G15545.1:1
Experimental Information
Sanger sequencing for BSS   NA
PCR primers for BSS    NA
Sanger sequencing for FL    NA
PCR primers for FL    NA
Sequences
Splice junction sequence   CGCTAAGCCGACACCAAACGgcaggaacaacgcaaatcat
Assembled circRNA sequence   NA
Full-length trsnacripts NA
Genomic sequence GCAGGAACAACGCAAATCATCGCTAAGCCGACACCAAACG
Conservation Information
Conserved circRNAs NA
PMCS 0.083333333
Functional Information
Coding potential N
Potential coding position NA
Potential amino acid sequence NA
Sponge-miRNAs NA
circRNA-miRNA-mRNA network  VISUALIZATION
Potential function description NA
Other Information
References Chu et al., 2017