Detail information of Os04g0220300_circ_g.1


General Information
CircRNA Name Os04g0220300_circ_g.1
ID in PlantcircBase osa_circ_041685
Alias NA
Organism Oryza sativa
Position chr4: 8009617-8009676  JBrowse»
Reference genome IRGSP-1.0.38
Type   e-circRNA
Identification method CIRI-long
Parent gene Os04g0220300
Parent gene annotation EGF-type aspartate/asparagine hydroxylation site domain containi
ng protein. (Os04t0220300-01)
Parent gene strand +
Alternative splicing NA
Support reads NA
Tissues leaf
Exon boundary   No-No
Splicing signals   AT-AC
Number of exons covered Os04t0220300-01:1
Experimental Information
Sanger sequencing for BSS   NA
PCR primers for BSS    NA
Sanger sequencing for FL    NA
PCR primers for FL    NA
Sequences
Splice junction sequence   ACGACGACAGCAGCAGCAGCAGGAGGGCAAagcagcagcagcagcagcacgggggcgacg
Assembled circRNA sequence   Yes
Full-length trsnacripts Transcript length: 60
Transcript exons: 8009617-8009676
AGCAGCAGCAGCAGCAGCACGGGGGCGACGACGACGACAGCAGCAGCAGCAGGAGGGCAA

Genomic sequence AGCAGCAGCAGCAGCAGCACGGGGGCGACGACGACGACAGCAGCAGCAGCAGGAGGGCAA
Conservation Information
Conserved circRNAs NA
PMCS 0.520119583
Functional Information
Coding potential N
Potential coding position NA
Potential amino acid sequence NA
Sponge-miRNAs NA
circRNA-miRNA-mRNA network  VISUALIZATION
Potential function description NA
Other Information
References this study