Detail information of EPlOSAG00000010972_circ_ig.1


General Information
CircRNA Name EPlOSAG00000010972_circ_ig.1
ID in PlantcircBase osa_circ_016077
Alias NA
Organism Oryza sativa
Position chr2: 28715367-28715419  JBrowse»
Reference genome IRGSP-1.0.38
Type   ig-circRNA
Identification method circseq_cup
Parent gene NA
Parent gene annotation NA
Parent gene strand NA
Alternative splicing Os02g0697600_circ_ag.1 Os02g0697600_circ_g.1 Os02g0697800_circ_g.1 Os02g0697800_circ_g.2 Os02g0697800_circ_g.3 Os02g0697900_circ_g.1 Os02g0697900_circ_g.2 Os02g0697900_circ_g.3 Os02g0697900_circ_g.4 Os02g0697900_circ_g.5 Os02g0697900_circ_g.6 Os02g0697900_circ_g.7 Os02g0697900_circ_g.8 Os02g0697900_circ_g.9 Os02g0697900_circ_g.10 Os02g0697900_circ_g.11 Os02g0697900_circ_g.12 Os02g0697900_circ_g.13 Os02g0697900_circ_g.14 Os02g0697900_circ_g.15 Os02g0697900_circ_g.16 Os02g0697900_circ_g.17 Os02g0697900_circ_g.18 Os02g0697900_circ_g.19 Os02g0697900_circ_g.20 Os02g0697900_circ_g.21 EPlOSAG00000010972_circ_ig.2 EPlOSAG00000010972_circ_ig.3 EPlOSAG00000023742_circ_ig.1 EPlOSAG00000008547_circ_igg.1
Support reads 5
Tissues root
Exon boundary   No-No
Splicing signals   GT-AC
Number of exons covered NA
Experimental Information
Sanger sequencing for BSS   NA
PCR primers for BSS    NA
Sanger sequencing for FL    NA
PCR primers for FL    NA
Sequences
Splice junction sequence   CGGCCCTTGAAAATCCGGAGGACCGAgtcgcgcggtgtccggtgcgcccccgg
Assembled circRNA sequence   Yes
Full-length trsnacripts Transcript length: 53
Transcript exons: 28715367-28715419
GTCGCGCGGTGTCCGGTGCGCCCCCGGCGGCCCTTGAAAATCCGGAGGACCGA

Genomic sequence GTCGCGCGGTGTCCGGTGCGCCCCCGGCGGCCCTTGAAAATCCGGAGGACCGA
Conservation Information
Conserved circRNAs NA
PMCS 1.001952673
Functional Information
Coding potential N
Potential coding position NA
Potential amino acid sequence NA
Sponge-miRNAs NA
circRNA-miRNA-mRNA network  VISUALIZATION
Potential function description NA
Other Information
References Ye et al., 2016