Detail information of Os01g0720500_circ_g.19


General Information
CircRNA Name Os01g0720500_circ_g.19
ID in PlantcircBase osa_circ_003699
Alias NA
Organism Oryza sativa
Position chr1: 30031620-30031679  JBrowse»
Reference genome IRGSP-1.0.38
Type   e-circRNA
Identification method CIRCexplorer
Parent gene Os01g0720500
Parent gene annotation Similar to Type I chlorophyll a/b-binding protein b (Fragment).
(Os01t0720500-01);Non-protein coding transcript. (Os01t0720500-0
2)
Parent gene strand +
Alternative splicing Os01g0720500_circ_g.1 Os01g0720500_circ_g.2 Os01g0720500_circ_g.3 Os01g0720500_circ_g.4 Os01g0720500_circ_g.5 Os01g0720500_circ_g.6 Os01g0720500_circ_g.7 Os01g0720500_circ_g.8 Os01g0720500_circ_g.9 Os01g0720500_circ_g.10 Os01g0720500_circ_g.11 Os01g0720500_circ_g.12 Os01g0720500_circ_g.13 Os01g0720500_circ_g.14 Os01g0720500_circ_g.15 Os01g0720500_circ_g.16 Os01g0720500_circ_g.17 Os01g0720500_circ_g.18 Os01g0720500_circ_g.20 Os01g0720500_circ_g.21 Os01g0720500_circ_g.22 Os01g0720500_circ_g.23 Os01g0720500_circ_g.24 Os01g0720500_circ_g.25 Os01g0720500_circ_g.26 Os01g0720500_circ_g.27 Os01g0720500_circ_g.28 Os01g0720500_circ_g.29 Os01g0720500_circ_g.30 Os01g0720500_circ_g.31
Support reads 1
Tissues leaf
Exon boundary   No-No
Splicing signals   CG-CC
Number of exons covered Os01t0720500-01:1
Experimental Information
Sanger sequencing for BSS   NA
PCR primers for BSS    NA
Sanger sequencing for FL    NA
PCR primers for FL    NA
Sequences
Splice junction sequence   CGGCGGCAGCTTCGACCCGCTCGGCCTCGCgctcggcgaggtcgtcgacccgctctaccc
Assembled circRNA sequence   NA
Full-length trsnacripts NA
Genomic sequence GCTCGGCGAGGTCGTCGACCCGCTCTACCCCGGCGGCAGCTTCGACCCGCTCGGCCTCGC
Conservation Information
Conserved circRNAs NA
PMCS 0.323608333
Functional Information
Coding potential N
Potential coding position NA
Potential amino acid sequence NA
Sponge-miRNAs NA
circRNA-miRNA-mRNA network  VISUALIZATION
Potential function description NA
Other Information
References Chu et al., 2017