Detail information of AT4G16143_circ_g.3


General Information
CircRNA Name AT4G16143_circ_g.3
ID in PlantcircBase ath_circ_031159
Alias NA
Organism Arabidpsis thaliana
Position chr4: 9134877-9134933  JBrowse»
Reference genome TAIR10.38
Type   i-circRNA
Identification method CIRCexplorer
Parent gene AT4G16143
Parent gene annotation Importin subunit alpha-2
Parent gene strand -
Alternative splicing AT4G16143_circ_g.1 AT4G16143_circ_g.2
Support reads 1
Tissues root
Exon boundary   No-No
Splicing signals   TT-CA
Number of exons covered 0
Experimental Information
Sanger sequencing for BSS   NA
PCR primers for BSS    NA
Sanger sequencing for FL    NA
PCR primers for FL    NA
Sequences
Splice junction sequence   ACATGGAGTTTATATCGGATAATCTTACaagattctaaaggagttgagatcaacaga
Assembled circRNA sequence   NA
Full-length trsnacripts NA
Genomic sequence AAGATTCTAAAGGAGTTGAGATCAACAGAACATGGAGTTTATATCGGATAATCTTAC
Conservation Information
Conserved circRNAs NA
PMCS 0.141812865
Functional Information
Coding potential N
Potential coding position NA
Potential amino acid sequence NA
Sponge-miRNAs NA
circRNA-miRNA-mRNA network  VISUALIZATION
Potential function description NA
Other Information
References Chu et al., 2017