Detail information of Os11g0242800_circ_g.24


General Information
CircRNA Name Os11g0242800_circ_g.24
ID in PlantcircBase osa_circ_008954
Alias NA
Organism Oryza sativa
Position chr11: 7662019-7662059  JBrowse»
Reference genome IRGSP-1.0.38
Type   u-circRNA
Identification method circRNA_finder
Parent gene Os11g0242800
Parent gene annotation Similar to ASCAB9-A (ASCAB9-B) (Fragment). (Os11t0242800-01)
Parent gene strand +
Alternative splicing NA
Support reads 3
Tissues leaf
Exon boundary   No-No
Splicing signals   GT-AG
Number of exons covered Os11t0242800-01:1
Experimental Information
Sanger sequencing for BSS   NA
PCR primers for BSS    NA
Sanger sequencing for FL    NA
PCR primers for FL    NA
Sequences
Splice junction sequence   TACGTGTAAATTATCGTCGAggtggaagaatgtgttaaatg
Assembled circRNA sequence   NA
Full-length trsnacripts NA
Genomic sequence GGTGGAAGAATGTGTTAAATGTACGTGTAAATTATCGTCGA
Conservation Information
Conserved circRNAs NA
PMCS 0.12398374
Functional Information
Coding potential N
Potential coding position NA
Potential amino acid sequence NA
Sponge-miRNAs NA
circRNA-miRNA-mRNA network  VISUALIZATION
Potential function description NA
Other Information
References Chu et al., 2017