Detail information of Os12g0230100_circ_g.4


General Information
CircRNA Name Os12g0230100_circ_g.4
ID in PlantcircBase osa_circ_043577
Alias NA
Organism Oryza sativa
Position chr12: 7097051-7097114  JBrowse»
Reference genome IRGSP-1.0.38
Type   e-circRNA
Identification method CIRI-long
Parent gene Os12g0230100
Parent gene annotation Similar to ATP-dependent Clp protease ATP-binding subunit clpA h
omolog, chloroplast precursor (Fragment). (Os12t0230100-01)
Parent gene strand -
Alternative splicing Os12g0230100_circ_g.1 Os12g0230100_circ_g.2 Os12g0230100_circ_g.3
Support reads NA
Tissues leaf
Exon boundary   No-No
Splicing signals   CT-AC
Number of exons covered Os12t0230100-01:1
Experimental Information
Sanger sequencing for BSS   NA
PCR primers for BSS    NA
Sanger sequencing for FL    NA
PCR primers for FL    NA
Sequences
Splice junction sequence   AGTCCACGAGGATACAATGTGCTGGATATCTGtcgtcacttgataccttctctactggaatacc
Assembled circRNA sequence   Yes
Full-length trsnacripts Transcript length: 64
Transcript exons: 7097051-7097114
TCGTCACTTGATACCTTCTCTACTGGAATACCAGTCCACGAGGATACAATGTGCTGGATATCTG

Genomic sequence TCGTCACTTGATACCTTCTCTACTGGAATACCAGTCCACGAGGATACAATGTGCTGGATATCTG
Conservation Information
Conserved circRNAs NA
PMCS 0.213541667
Functional Information
Coding potential N
Potential coding position NA
Potential amino acid sequence NA
Sponge-miRNAs NA
circRNA-miRNA-mRNA network  VISUALIZATION
Potential function description NA
Other Information
References this study