logo





circRNA ID
AT1G01140_circ_g.6
Alias
ath_circ_000027
Organism
Arabidpsis thaliana
Position
chr1: 66387-66449  JBrowse»
Reference genome
TAIR10.38
Type  
i-circRNA
Identification method
CIRCexplorer
Parent gene
Parent gene annotation
CBL-interacting protein kinase 9
Parent gene strand
-
Splice junction sequence  
CAAGAAGAGTGCACAAAAACAAAAGAAAGACctaagaagaatgaatatcgtaatcacaggaaa
Support reads
1
Tissues
aerial
Exon boundary  
No-No
Splicing signals  
CT-AA
Sanger sequencing for BSS  
NA
PCR primers for BSS  
NA
Assembled circRNA sequence  
NA
Sanger sequencing for FL  
NA
PCR primers for FL  
NA
Genomic sequence
CTAAGAAGAATGAATATCGTAATCACAGGAAACAAGAAGAGTGCACAAAAACAAAAGAAAGAC
Number of exons covered
0
Conserved circRNAs
NA
Coding potential
N
Potential coding position
NA
Potential amino acid sequence
NA
Sponge-miRNAs
NA
circRNA-miRNA-mRNA network
References
Chu et al., 2017

Copyright©2017-2021 Institute of Crop Sciences / Institute of Bioinformatics, Zhejiang University.
Any questions or suggestions, please contact the Fan's lab, bioinplant@zju.edu.cn
For submittion, please click here. Last modified at 2021-03-09.

Supported by   nsfc    zju