Detail information of Zm00001d047789_circ_g.2


General Information
CircRNA Name Zm00001d047789_circ_g.2
ID in PlantcircBase zma_circ_005963
Alias heat_test_circ_002707
Organism Zea mays
Position chr9: 141794053-141794116  JBrowse»
Reference genome AGPv4.38
Type   e-circRNA
Identification method find_circ
Parent gene Zm00001d047789
Parent gene annotation ATP synthase B chain
Parent gene strand +
Alternative splicing Zm00001d047789_circ_g.1
Support reads NA
Tissues seedling
Exon boundary   No-No
Splicing signals   GT-AA
Number of exons covered Zm00001d047789_T001:1
Experimental Information
Sanger sequencing for BSS   NA
PCR primers for BSS    NA
Sanger sequencing for FL    NA
PCR primers for FL    NA
Sequences
Splice junction sequence   TCGCCTCGCTCAGTGATGAGATCGTCAAGAAGggaggaggctgttaaggcgctcgacgcccaga
Assembled circRNA sequence   NA
Full-length trsnacripts NA
Genomic sequence GGAGGAGGCTGTTAAGGCGCTCGACGCCCAGATCGCCTCGCTCAGTGATGAGATCGTCAAGAAG
Conservation Information
Conserved circRNAs NA
PMCS 0.605008203
Functional Information
Coding potential N
Potential coding position NA
Potential amino acid sequence NA
Sponge-miRNAs NA
circRNA-miRNA-mRNA network  VISUALIZATION
Potential function description NA
Other Information
References Tang et al., 2018