Detail information of AT4G32390_circ_g.4


General Information
CircRNA Name AT4G32390_circ_g.4
ID in PlantcircBase ath_circ_034035
Alias NA
Organism Arabidpsis thaliana
Position chr4: 15637566-15637626  JBrowse»
Reference genome TAIR10.38
Type   ue-circRNA
Identification method CIRI
Parent gene AT4G32390
Parent gene annotation Probable sugar phosphate/phosphate translocator At4g32390
Parent gene strand +
Alternative splicing AT4G32390_circ_g.3
Support reads 15
Tissues root
Exon boundary   No-No
Splicing signals   GT-AG
Number of exons covered AT4G32390.1:1
Experimental Information
Sanger sequencing for BSS   NA
PCR primers for BSS    NA
Sanger sequencing for FL    NA
PCR primers for FL    NA
Sequences
Splice junction sequence   GACTGATTGAGTTGATGATCATAAGGAAAGtgaagctgctgcgaaacggaatgaaacagaa
Assembled circRNA sequence   NA
Full-length trsnacripts NA
Genomic sequence TGAAGCTGCTGCGAAACGGAATGAAACAGAAGACTGATTGAGTTGATGATCATAAGGAAAG
Conservation Information
Conserved circRNAs NA
PMCS 0.083333333
Functional Information
Coding potential N
Potential coding position NA
Potential amino acid sequence NA
Sponge-miRNAs NA
circRNA-miRNA-mRNA network  VISUALIZATION
Potential function description NA
Other Information
References Chu et al., 2017