Detail information of Os07g0106200_circ_g.3


General Information
CircRNA Name Os07g0106200_circ_g.3
ID in PlantcircBase osa_circ_042475
Alias NA
Organism Oryza sativa
Position chr7: 353117-353164  JBrowse»
Reference genome IRGSP-1.0.38
Type   e-circRNA
Identification method CIRI-long
Parent gene Os07g0106200
Parent gene annotation Similar to Hexose transporter. (Os07t0106200-02);Similar to Mono
saccharide transporter 3. (Os07t0106200-03)
Parent gene strand -
Alternative splicing Os07g0106200_circ_g.4
Support reads NA
Tissues root
Exon boundary   No-No
Splicing signals   GT-AG
Number of exons covered Os07t0106200-02:1
Experimental Information
Sanger sequencing for BSS   NA
PCR primers for BSS    NA
Sanger sequencing for FL    NA
PCR primers for FL    NA
Sequences
Splice junction sequence   GAAGGAGGAGACGAGGGCGGCGAGgacgcgggtgacggtggcggcgaa
Assembled circRNA sequence   Yes
Full-length trsnacripts Transcript length: 48
Transcript exons: 353117-353164
GACGCGGGTGACGGTGGCGGCGAAGAAGGAGGAGACGAGGGCGGCGAG

Genomic sequence GACGCGGGTGACGGTGGCGGCGAAGAAGGAGGAGACGAGGGCGGCGAG
Conservation Information
Conserved circRNAs NA
PMCS 0.381942014
Functional Information
Coding potential N
Potential coding position NA
Potential amino acid sequence NA
Sponge-miRNAs NA
circRNA-miRNA-mRNA network  VISUALIZATION
Potential function description NA
Other Information
References this study