Detail information of AT4G35570_circ_g.3


General Information
CircRNA Name AT4G35570_circ_g.3
ID in PlantcircBase ath_circ_034831
Alias NA
Organism Arabidpsis thaliana
Position chr4: 16888138-16888192  JBrowse»
Reference genome TAIR10.38
Type   ue-circRNA
Identification method CIRCexplorer, PcircRNA_finder
Parent gene AT4G35570
Parent gene annotation High mobility group B protein 5
Parent gene strand -
Alternative splicing NA
Support reads 4
Tissues root, leaf, aerial, whole_plant
Exon boundary   Yes-Yes
Splicing signals   CT-AC
Number of exons covered AT4G35570.1:1
AT4G35570.2:1
Experimental Information
Sanger sequencing for BSS   NA
PCR primers for BSS    NA
Sanger sequencing for FL    NA
PCR primers for FL    NA
Sequences
Splice junction sequence   CCGTTTGGTTATCTTTCATCTCGAGATctatcatcagtgctcctcgattcaactt
Assembled circRNA sequence   NA
Full-length trsnacripts NA
Genomic sequence CTATCATCAGTGCTCCTCGATTCAACTTCCGTTTGGTTATCTTTCATCTCGAGAT
Conservation Information
Conserved circRNAs NA
PMCS 0.113636364
Functional Information
Coding potential N
Potential coding position NA
Potential amino acid sequence NA
Sponge-miRNAs NA
circRNA-miRNA-mRNA network  VISUALIZATION
Potential function description NA
Other Information
References Chu et al., 2017