Detail information of Os01g0180900_circ_g.1


General Information
CircRNA Name Os01g0180900_circ_g.1
ID in PlantcircBase osa_circ_000548
Alias NA
Organism Oryza sativa
Position chr1: 4264945-4264992  JBrowse»
Reference genome IRGSP-1.0.38
Type   e-circRNA
Identification method PcircRNA_finder
Parent gene Os01g0180900
Parent gene annotation 2-oxoglutarate and iron-dependent oxygenase, Starch accumulation
(Os01t0180900-01)
Parent gene strand +
Alternative splicing NA
Support reads 2
Tissues seed
Exon boundary   Yes-Yes
Splicing signals   GT-AG
Number of exons covered Os01t0180900-01:1
Experimental Information
Sanger sequencing for BSS   NA
PCR primers for BSS    NA
Sanger sequencing for FL    NA
PCR primers for FL    NA
Sequences
Splice junction sequence   GAAAGGATCTTGTCCGCATACCAGacgcagaatcagagggagtacagg
Assembled circRNA sequence   NA
Full-length trsnacripts NA
Genomic sequence ACGCAGAATCAGAGGGAGTACAGGGAAAGGATCTTGTCCGCATACCAG
Conservation Information
Conserved circRNAs NA
PMCS 0.083333333
Functional Information
Coding potential N
Potential coding position NA
Potential amino acid sequence NA
Sponge-miRNAs NA
circRNA-miRNA-mRNA network  VISUALIZATION
Potential function description NA
Other Information
References Chu et al., 2017