Detail information of Os03g0160200_circ_g.1


General Information
CircRNA Name Os03g0160200_circ_g.1
ID in PlantcircBase osa_circ_018056
Alias NA
Organism Oryza sativa
Position chr3: 3209130-3209167  JBrowse»
Reference genome IRGSP-1.0.38
Type   i-circRNA
Identification method CIRCexplorer
Parent gene Os03g0160200
Parent gene annotation Conserved hypothetical protein. (Os03t0160200-01);Conserved hypo
thetical protein. (Os03t0160200-02)
Parent gene strand +
Alternative splicing NA
Support reads 1
Tissues leaf
Exon boundary   No-No
Splicing signals   GA-CG
Number of exons covered 0
Experimental Information
Sanger sequencing for BSS   NA
PCR primers for BSS    NA
Sanger sequencing for FL    NA
PCR primers for FL    NA
Sequences
Splice junction sequence   GTTTCGAGGTTTCTGATTTgtgagtttgggagctgtgt
Assembled circRNA sequence   NA
Full-length trsnacripts NA
Genomic sequence GTGAGTTTGGGAGCTGTGTGTTTCGAGGTTTCTGATTT
Conservation Information
Conserved circRNAs NA
PMCS 0.083333333
Functional Information
Coding potential N
Potential coding position NA
Potential amino acid sequence NA
Sponge-miRNAs NA
circRNA-miRNA-mRNA network  VISUALIZATION
Potential function description NA
Other Information
References Chu et al., 2017