Detail information of Zm00001d027720_circ_g.2


General Information
CircRNA Name Zm00001d027720_circ_g.2
ID in PlantcircBase zma_circ_003294
Alias heat_test_circ_006836
Organism Zea mays
Position chr1: 12139302-12139356  JBrowse»
Reference genome AGPv4.38
Type   e-circRNA
Identification method find_circ
Parent gene Zm00001d027720
Parent gene annotation Heavy metal-associated isoprenylated plant protein 27
Parent gene strand -
Alternative splicing Zm00001d027720_circ_g.1
Support reads NA
Tissues seedling
Exon boundary   No-No
Splicing signals   CT-CA
Number of exons covered Zm00001d027720_T001:1
Experimental Information
Sanger sequencing for BSS   NA
PCR primers for BSS    NA
Sanger sequencing for FL    NA
PCR primers for FL    NA
Sequences
Splice junction sequence   CGACACCTTGTTCTGCTTCTGGTCCACcctccggcgcctccacgtgcccggacac
Assembled circRNA sequence   NA
Full-length trsnacripts NA
Genomic sequence CCTCCGGCGCCTCCACGTGCCCGGACACCGACACCTTGTTCTGCTTCTGGTCCAC
Conservation Information
Conserved circRNAs NA
PMCS 0.639393939
Functional Information
Coding potential N
Potential coding position NA
Potential amino acid sequence NA
Sponge-miRNAs NA
circRNA-miRNA-mRNA network  VISUALIZATION
Potential function description NA
Other Information
References Tang et al., 2018