Detail information of Os11g0521500_circ_g.2


General Information
CircRNA Name Os11g0521500_circ_g.2
ID in PlantcircBase osa_circ_043436
Alias NA
Organism Oryza sativa
Position chr11: 18751642-18751700  JBrowse»
Reference genome IRGSP-1.0.38
Type   e-circRNA
Identification method CIRI-long
Parent gene Os11g0521500
Parent gene annotation Similar to Acyl carrier protein, chloroplast precursor (ACP) (AC
P05) (Clone 29C08). (Os11t0521500-01)
Parent gene strand -
Alternative splicing Os11g0521500_circ_g.1 Os11g0521500_circ_g.3 Os11g0521500_circ_g.4 Os11g0521500_circ_g.5 Os11g0521500_circ_g.6
Support reads NA
Tissues leaf
Exon boundary   No-No
Splicing signals   CT-AC
Number of exons covered Os11t0521500-01:1
Experimental Information
Sanger sequencing for BSS   NA
PCR primers for BSS    NA
Sanger sequencing for FL    NA
PCR primers for FL    NA
Sequences
Splice junction sequence   CACGATCTCCACCGTGTCCAGCGAGTCCGggtgatcccgaactcctcctccagcgccat
Assembled circRNA sequence   Yes
Full-length trsnacripts Transcript length: 59
Transcript exons: 18751642-18751700
GGTGATCCCGAACTCCTCCTCCAGCGCCATCACGATCTCCACCGTGTCCAGCGAGTCCG

Genomic sequence GGTGATCCCGAACTCCTCCTCCAGCGCCATCACGATCTCCACCGTGTCCAGCGAGTCCG
Conservation Information
Conserved circRNAs NA
PMCS 0.324502542
Functional Information
Coding potential N
Potential coding position NA
Potential amino acid sequence NA
Sponge-miRNAs NA
circRNA-miRNA-mRNA network  VISUALIZATION
Potential function description NA
Other Information
References this study