Detail information of Os02g0306401_circ_g.32


General Information
CircRNA Name Os02g0306401_circ_g.32
ID in PlantcircBase osa_circ_014420
Alias NA
Organism Oryza sativa
Position chr2: 12002322-12002381  JBrowse»
Reference genome IRGSP-1.0.38
Type   e-circRNA
Identification method circseq_cup
Parent gene Os02g0306401
Parent gene annotation Similar to Nicotianamine aminotransferase A. (Os02t0306401-00)
Parent gene strand -
Alternative splicing Os02g0306401_circ_g.13 Os02g0306401_circ_g.14 Os02g0306401_circ_g.15 Os02g0306401_circ_g.16 Os02g0306401_circ_g.17 Os02g0306401_circ_g.18 Os02g0306401_circ_g.19 Os02g0306401_circ_g.20 Os02g0306401_circ_g.21 Os02g0306401_circ_g.22 Os02g0306401_circ_g.23 Os02g0306401_circ_g.24 Os02g0306401_circ_g.25 Os02g0306401_circ_g.26 Os02g0306401_circ_g.27 Os02g0306401_circ_g.28 Os02g0306401_circ_g.29 Os02g0306401_circ_g.30 Os02g0306401_circ_g.31
Support reads 3
Tissues root
Exon boundary   No-No
Splicing signals   TC-GA
Number of exons covered Os02t0306401-00:1
Experimental Information
Sanger sequencing for BSS   NA
PCR primers for BSS    NA
Sanger sequencing for FL    NA
PCR primers for FL    NA
Sequences
Splice junction sequence   TGTCCCCCGCCGCCGCCATCGCGCCGCCCCtcttgtaccgcaccgcccggatgctcatct
Assembled circRNA sequence   Yes
Full-length trsnacripts Transcript length: 60
Transcript exons: 12002322-12002381
TCTTGTACCGCACCGCCCGGATGCTCATCTTGTCCCCCGCCGCCGCCATCGCGCCGCCCC

Genomic sequence TCTTGTACCGCACCGCCCGGATGCTCATCTTGTCCCCCGCCGCCGCCATCGCGCCGCCCC
Conservation Information
Conserved circRNAs NA
PMCS 0.216665139
Functional Information
Coding potential N
Potential coding position NA
Potential amino acid sequence NA
Sponge-miRNAs NA
circRNA-miRNA-mRNA network  VISUALIZATION
Potential function description NA
Other Information
References Ye et al., 2016