Detail information of Os01g0915900_circ_g.10


General Information
CircRNA Name Os01g0915900_circ_g.10
ID in PlantcircBase osa_circ_005447
Alias NA
Organism Oryza sativa
Position chr1: 39919869-39919928  JBrowse»
Reference genome IRGSP-1.0.38
Type   e-circRNA
Identification method circseq_cup
Parent gene Os01g0915900
Parent gene annotation Conserved hypothetical protein. (Os01t0915900-01)
Parent gene strand -
Alternative splicing Os01g0915900_circ_g.3 Os01g0915900_circ_g.4 Os01g0915900_circ_g.5 Os01g0915900_circ_g.6 Os01g0915900_circ_g.7 Os01g0915900_circ_g.8 Os01g0915900_circ_g.9 Os01g0915900_circ_g.11 Os01g0915900_circ_g.12 Os01g0915900_circ_g.13
Support reads 8
Tissues root
Exon boundary   No-No
Splicing signals   TG-AA
Number of exons covered Os01t0915900-01:1
Experimental Information
Sanger sequencing for BSS   NA
PCR primers for BSS    NA
Sanger sequencing for FL    NA
PCR primers for FL    NA
Sequences
Splice junction sequence   ATAGCCGCCGCCGCCGCCGTAGTAGGAGCCtgatccgccgtaggaagtgttgccgccgcc
Assembled circRNA sequence   Yes
Full-length trsnacripts Transcript length: 60
Transcript exons: 39919869-39919928
TGATCCGCCGTAGGAAGTGTTGCCGCCGCCATAGCCGCCGCCGCCGCCGTAGTAGGAGCC

Genomic sequence TGATCCGCCGTAGGAAGTGTTGCCGCCGCCATAGCCGCCGCCGCCGCCGTAGTAGGAGCC
Conservation Information
Conserved circRNAs NA
PMCS 0.2991175
Functional Information
Coding potential N
Potential coding position NA
Potential amino acid sequence NA
Sponge-miRNAs NA
circRNA-miRNA-mRNA network  VISUALIZATION
Potential function description NA
Other Information
References Ye et al., 2016