Detail information of Os07g0529800_circ_g.7


General Information
CircRNA Name Os07g0529800_circ_g.7
ID in PlantcircBase osa_circ_034141
Alias NA
Organism Oryza sativa
Position chr7: 20735131-20735172  JBrowse»
Reference genome IRGSP-1.0.38
Type   u-circRNA
Identification method CIRI
Parent gene Os07g0529800
Parent gene annotation Protein translation factor SUI1 homolog (GOS2 protein). (Os07t05
29800-01)
Parent gene strand -
Alternative splicing Os07g0529800_circ_igg.1 Os07g0529800_circ_igg.2 Os07g0529800_circ_igg.3 Os07g0529800_circ_igg.4 Os07g0529800_circ_igg.5 Os07g0529800_circ_g.1 Os07g0529800_circ_g.2 Os07g0529800_circ_g.3 Os07g0529800_circ_g.4 Os07g0529800_circ_g.5 Os07g0529800_circ_g.6
Support reads 2
Tissues shoot
Exon boundary   Yes-No
Splicing signals   CT-AC
Number of exons covered Os07t0529800-01:1
Experimental Information
Sanger sequencing for BSS   NA
PCR primers for BSS    NA
Sanger sequencing for FL    NA
PCR primers for FL    NA
Sequences
Splice junction sequence   AGGGAAGAGATCGACCAAGAAcctgtgaggaggaggtggagg
Assembled circRNA sequence   NA
Full-length trsnacripts NA
Genomic sequence CCTGTGAGGAGGAGGTGGAGGAGGGAAGAGATCGACCAAGAA
Conservation Information
Conserved circRNAs NA
PMCS 0.470236111
Functional Information
Coding potential N
Potential coding position NA
Potential amino acid sequence NA
Sponge-miRNAs NA
circRNA-miRNA-mRNA network  VISUALIZATION
Potential function description NA
Other Information
References Chu et al., 2017